Cloning

From Bradwiki
Jump to: navigation, search

Molecular cloning is a set of experimental methods in molecular biology that are used to assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word cloning refers to the fact that the method involves the replication of one molecule to produce a population of cells with identical DNA molecules. Molecular cloning generally uses DNA sequences from two different organisms: the species that is the source of the DNA to be cloned, and the species that will serve as the living host for replication of the recombinant DNA. Molecular cloning methods are central to many contemporary areas of modern biology and medicine.

Molecular cloning is similar to polymerase chain reaction (PCR) in that it permits the replication of DNA sequence. The fundamental difference between the two methods is that molecular cloning involves replication of the DNA in a living microorganism, while PCR replicates DNA in an in vitro solution, free of living cells.


Plasmid Vector

see also: Plasmid

A cloning vector is a small piece of DNA, taken from a virus, a plasmid, or the cell of a higher organism, that can be stably maintained in an organism, and into which a foreign DNA fragment can be inserted for cloning purposes. The vector therefore contains features that allow for the convenient insertion or removal of DNA fragment in or out of the vector, for example by treating the vector and the foreign DNA with a restriction enzyme that creates the same overhang, then ligating the fragments together. After a DNA fragment has been cloned into a cloning vector, it may be further subcloned into another vector designed for more specific use.


Specialized applications may call for specialized host-vector systems. For example, if the experimentalists wish to harvest a particular protein from the recombinant organism, then an expression vector is chosen that contains appropriate signals for transcription and translation in the desired host organism. Alternatively, if replication of the DNA in different species is desired (for example, transfer of DNA from bacteria to plants), then a multiple host range vector (also termed shuttle vector) may be selected. In practice, however, specialized molecular cloning experiments usually begin with cloning into a bacterial plasmid, followed by subcloning into a specialized vector.


A cloning vector almost always contains four DNA segments critically important to its function and experimental utility:

  1. DNA replication origin is necessary for the vector (and its linked recombinant sequences) to replicate inside the host organism
  2. one or more unique restriction endonuclease recognition sites to serve as sites where foreign DNA may be introduced
  3. a selectable genetic marker gene that can be used to enable the survival of cells that have taken up vector sequences
  4. a tag gene that can be used to screen for cells containing the foreign DNA

Restriction Endonuclease

Cleavage of a DNA sequence containing the BamHI restriction site. The DNA is cleaved at the palindromic sequence to produce 'sticky ends'.

A restriction enzyme or restriction endonuclease is an enzyme that cuts DNA at or near specific recognition nucleotide sequences known as restriction sites. Restriction enzymes are commonly classified into three types, which differ in their structure and whether they cut their DNA substrate at their recognition site, or if the recognition and cleavage sites are separate from one another. To cut DNA, all restriction enzymes make two incisions, once through each sugar-phosphate backbone strand of the DNA double helix.

Over 3000 restriction enzymes have been studied in detail, and more than 600 of these are available commercially. These enzymes are routinely used for DNA modification in laboratories, and are a vital tool in molecular cloning.

Example Clone

Recombinant DNA

ATTGACGGCGTAGTACACACTATTGAATCAAACAGCCGACCAATTGCACTACCATCACAATGGAGAAGCCAGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTG TCGTGCAACTGCAAAAAAGCTTCCCGCAATTTGAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCTAATGCCAGAGCATTTTCGCATCTGGCCAGTAAACTAA TCGAGCTGGAGGTTCCTACCACAGCGACGATCTTGGACATAGGCAGCGCACCGGCTCGTAGAATGTTTTCCGAGCACCAGTATCATTGTGTCTGCCCCATGCGTAGTC CAGAAGACCCGGACCGCATGATGAAATACGCCAGTAAACTGGCGGAAAAAGCGTGCAAGATTACAAACAAGAACTTGCATGAGAAGATTAAGGATCTCCGGACCGTAC TTGATACGCCGGATGCTGAAACACCATCGCTCTGCTTTCACAACGATGTTACCTGCAACATGCGTGCCGAATATTCCGTCATGCAGGACGTGTATATCAACGCTCCCG GAACTATCTATCATCAGGCTATGAAAGGCGTGCGGACCCTGTACTGGATTGGCTTCGACACCACCCAGTTCATGTTCTCGGCTATGGCAGGTTCGTACCCTGCGTACA ACACCAACTGGGCCGACGAGAAAGTCCTTGAAGCGCGTAACATCGGACTTTGCAGCACAAAGCTGAGTGAAGGTAGGACAGGAAAATTGTCGATAATGAGGAAGAAGG AGTTGAAGCCCGGGTCGCGGGTTTATTTCTCCGTAGGATCGACACTTTATCCAGAACACAGAGCCAGCTTGCAGAGCTGGCATCTTCCATCGGTGTTCCACTTGAATG GAAAGCAGTCGTACACTTGCCGCTGTGATACAGTGGTGAGTTGCGAAGGCTACGTAGTGAAGAAAATCACCATCAGTCCCGGGATCACGGGAGAAACCGTGGGATACG CGGTTACACACAATAGCGAGGGCTTCTTGCTATGCAAAGTTACTGACACAGTAAAAGGAGAACGGGTATCGTTCCCTGTGTGCACGTACATCCCGGCCACCATATGCG ATCAGATGACTGGTATAATGGCCACGGATATATCACCTGACGATGCACAAAAACTTCTGGTTGGGCTCAACCAGCGAATTGTCATTAACGGTAGGACTAACAGGAACA CCAACACCATGCAAAATTACCTTCTGCCGATCATAGCACAAGGGTTCAGCAAATGGGCTAAGGAGCGCAAGGATGATCTTGATAACGAGAAAATGCTGGGTACTAGAG AACGCAAGCTTACGTATGGCTGCTTGTGGGCGTTTCGCACTAAGAAAGTACATTCGTTTTATCGCCCACCTGGAACGCAGACCTGCGTAAAAGTCCCAGCCTCTTTTA GCGCTTTTCCCATGTCGTCCGTATGGACGACCTCTTTGCCCATGTCGCTGAGGCAGAAATTGAAACTGGCATTGCAACCAAAGAAGGAGGAAAAACTGCTGCAGGTCT CGGAGGAATTAGTCATGGAGGCCAAGGCTGCTTTTGAGGATGCTCAGGAGGAAGCCAGAGCGGAGAAGCTCCGAGAAGCACTTCCACCATTAGTGGCAGACAAAGGCA TCGAGGCAGCCGCAGAAGTTGTCTGCGAAGTGGAGGGGCTCCAGGCGGACATCGGAGCAGCATTAGTTGAAACCCCGCGCGGTCACGTAAGGATAATACCTCAAGCAA ATGACCGTATGATCGGACAGTATATCGTTGTCTCGCCAAACTCTGTGCTGAAGAATGCCAAACTCGCACCAGCGCACCCGCTAGCAGATCAGGTTAAGATCATAACAC ACTCCGGAAGATCAGGAAGGTACGCGGTCGAACCATACGACGCTAAAGTACTGATGCCAGCAGGAGGTGCCGTACCATGGCCAGAATTCCTAGCACTGAGTGAGAGCG CCACGTTAGTGTACAACGAAAGAGAGTTTGTGAACCGCAAACTATACCACATTGCCATGCATGGCCCCGCCAAGAATACAGAAGAGGAGCAGTACAAGGTTACAAAGG CAGAGCTTGCAGAAACAGAGTACGTGTTTGACGTGGACAAGAAGCGTTGCGTTAAGAAGGAAGAAGCCTCAGGTCTGGTCCTCTCGGGAGAACTGACCAACCCTCCCT ATCATGAGCTAGCTCTGGAGGGACTGAAGACCCGACCTGCGGTCCCGTACAAGGTCGAAACAATAGGAGTGATAGGCACACCGGGGTCGGGCAAGTCAGCTATTATCA AGTCAACTGTCACGGCACGAGATCTTGTTACCAGCGGAAAGAAAGAAAATTGTCGCGAAATTGAGGCCGACGTGCTAAGACTGAGGGGTATGCAGATTACGTCGAAGA CAGTAGATTCGGTTATGCTCAACGGATGCCACAAAGCCGTAGAAGTGCTGTACGTTGACGAAGCGTTCGCGTGCCACGCAGGAGCACTACTTGCCTTGATTGCTATCG TCAGGCCCCGCAAGAAGGTAGTACTATGCGGAGACCCCATGCAATGCGGATTCTTCAACATGATGCAACTAAAGGTACATTTCAATCACCCTGAAAAAGACATATGCA CCAAGACATTCTACAAGTATATCTCCCGGCGTTGCACACAGCCAGTTACAGCTATTGTATCGACACTGCATTACGATGGAAAGATGAAAACCACGAACCCGTGCAAGA AGAACATTGAAATCGATATTACAGGGGCCACAAAGCCGAAGCCAGGGGATATCATCCTGACATGTTTCCGCGGGTGGGTTAAGCAATTGCAAATCGACTATCCCGGAC ATGAAGTAATGACAGCCGCGGCCTCACAAGGGCTAACCAGAAAAGGAGTGTATGCCGTCCGGCAAAAAGTCAATGAAAACCCACTGTACGCGATCACATCAGAGCATG TGAACGTGTTGCTCACCCGCACTGAGGACAGGCTAGTGTGGAAAACCTTGCAGGGCGACCCATGGATTAAGCAGCCCACTAACATACCTAAAGGAAACTTTCAGGCTA CTATAGAGGACTGGGAAGCTGAACACAAGGGAATAATTGCTGCAATAAACAGCCCCACTCCCCGTGCCAATCCGTTCAGCTGCAAGACCAACGTTTGCTGGGCGAAAG CATTGGAACCGATACTAGCCACGGCCGGTATCGTACTTACCGGTTGCCAGTGGAGCGAACTGTTCCCACAGTTTGCGGATGACAAACCACATTCGGCCATTTACGCCT TAGACGTAATTTGCATTAAGTTTTTCGGCATGGACTTGACAAGCGGACTGTTTTCTAAACAGAGCATCCCACTAACGTACCATCCCGCCGATTCAGCGAGGCCGGTAG CTCATTGGGACAACAGCCCAGGAACCCGCAAGTATGGGTACGATCACGCCATTGCCGCCGAACTCTCCCGTAGATTTCCGGTGTTCCAGCTAGCTGGGAAGGGCACAC AACTTGATTTGCAGACGGGGAGAACCAGAGTTATCTCTGCACAGCATAACCTGGTCCCGGTGAACCGCAATCTTCCTCACGCCTTAGTCCCCGAGTACAAGGAGAAGC AACCCGGCCCGGTCAAAAAATTCTTGAACCAGTTCAAACACCACTCAGTACTTGTGGTATCAGAGGAAAAAATTGAAGCTCCCCGTAAGAGAATCGAATGGATCGCCC CGATTGGCATAGCCGGTGCAGATAAGAACTACAACCTGGCTTTCGGGTTTCCGCCGCAGGCACGGTACGACCTGGTGTTCATCAACATTGGAACTAAATACAGAAACC ACCACTTTCAGCAGTGCGAAGACCATGCGGCGACCTTAAAAACCCTTTCGCGTTCGGCCCTGAATTGCCTTAACCCAGGAGGCACCCTCGTGGTGAAGTCCTATGGCT ACGCCGACCGCAACAGTGAGGACGTAGTCACCGCTCTTGCCAGAAAGTTTGTCAGGGTGTCTGCAGCGAGACCAGATTGTGTCTCAAGCAATACAGAAATGTACCTGA TTTTCCGACAACTAGACAACAGCCGTACACGGCAATTCACCCCGCACCATCTGAATTGCGTGATTTCGTCCGTGTATGAGGGTACAAGAGATGGAGTTGGAGCCGCGC CGTCATACCGCACCAAAAGGGAGAATATTGCTGACTGTCAAGAGGAAGCAGTTGTCAACGCAGCCAATCCGCTGGGTAGACCAGGCGAAGGAGTCTGCCGTGCCATCT ATAAACGTTGGCCGACCAGTTTTACCGATTCAGCCACGGAGACAGGCACCGCAAGAATGACTGTGTGCCTAGGAAAGAAAGTGATCCACGCGGTCGGCCCTGATTTCC GGAAGCACCCAGAAGCAGAAGCCTTGAAATTGCTACAAAACGCCTACCATGCAGTGGCAGACTTAGTAAATGAACATAACATCAAGTCTGTCGCCATTCCACTGCTAT CTACAGGCATTTACGCAGCCGGAAAAGACCGCCTTGAAGTATCACTTAACTGCTTGACAACCGCGCTAGACAGAACTGACGCGGACGTAACCATCTATTGCCTGGATA AGAAGTGGAAGGAAAGAATCGACGCGGCACTCCAACTTAAGGAGTCTGTAACAGAGCTGAAGGATGAAGATATGGAGATCGACGATGAGTTAGTATGGATTCATCCAG ACAGTTGCTTGAAGGGAAGAAAGGGATTCAGTACTACAAAAGGAAAATTGTATTCGTACTTCGAAGGCACCAAATTCCATCAAGCAGCAAAAGACATGGCGGAGATAA AGGTCCTGTTCCCTAATGACCAGGAAAGTAATGAACAACTGTGTGCCTACATATTGGGTGAGACCATGGAAGCAATCCGCGAAAAGTGCCCGGTCGACCATAACCCGT CGTCTAGCCCGCCCAAAACGTTGCCGTGCCTTTGCATGTATGCCATGACGCCAGAAAGGGTCCACAGACTTAGAAGCAATAACGTCAAAGAAGTTACAGTATGCTCCT CCACCCCCCTTCCTAAGCACAAAATTAAGAATGTTCAGAAGGTTCAGTGCACGAAAGTAGTCCTGTTTAATCCGCACACTCCCGCATTCGTTCCCGCCCGTAAGTACA TAGAAGTGCCAGAACAGCCTACCGCTCCTCCTGCACAGGCCGAGGAGGCCCCCGAAGTTGTAGCGACACCGTCACCATCTACAGCTGATAACACCTCGCTTGATGTCA CAGACATCTCACTGGATATGGATGACAGTAGCGAAGGCTCACTTTTTTCGAGCTTTAGCGGATCGGACAACTCTATTACTAGTATGGACAGTTGGTCGTCAGGACCTA GTTCACTAGAGATAGTAGACCGAAGGCAGGTGGTGGTGGCTGACGTTCATGCCGTCCAAGAGCCTGCCCCTATTCCACCGCCAAGGCTAAAGAAGATGGCCCGCCTGG CAGCGGCAAGAAAAGAGCCCACTCCACCGGCAAGCAATAGCTCTGAGTCCCTCCACCTCTCTTTTGGTGGGGTATCCATGTCCCTCGGATCAATTTTCGACGGAGAGA CGGCCCGCCAGGCAGCGGTACAACCCCTGGCAACAGGCCCCACGGATGTGCCTATGTCTTTCGGATCGTTTTCCGACGGAGAGATTGATGAGCTGAGCCGCAGAGTAA CTGAGTCCGAACCCGTCCTGTTTGGATCATTTGAACCGGGCGAAGTGAACTCAATTATATCGTCCCGATCAGCCGTATCTTTTCCACTACGCAAGCAGAGACGTAGAC GCAGGAGCAGGAGGACTGAATACTGACTAACCGGGGTAGGTGGGTACATATTTTCGACGGACACAGGCCCTGGGCACTTGCAAAAGAAGTCCGTTCTGCAGAACCAGC TTACAGAACCGACCTTGGAGCGCAATGTCCTGGAAAGAATTCATGCCCCGGTGCTCGACACGTCGAAAGAGGAACAACTCAAACTCAGGTACCAGATGATGCCCACCG AAGCCAACAAAAGTAGGTACCAGTCTCGTAAAGTAGAAAATCAGAAAGCCATAACCACTGAGCGACTACTGTCAGGACTACGACTGTATAACTCTGCCACAGATCAGC CAGAATGCTATAAGATCACCTATCCGAAACCATTGTACTCCAGTAGCGTACCGGCGAACTACTCCGATCCACAGTTCGCTGTAGCTGTCTGTAACAACTATCTGCATG AGAACTATCCGACAGTAGCATCTTATCAGATTACTGACGAGTACGATGCTTACTTGGATATGGTAGACGGGACAGTCGCCTGCCTGGATACTGCAACCTTCTGCCCCG CTAAGCTTAGAAGTTACCCGAAAAAACATGAGTATAGAGCCCCGAATATCCGCAGTGCGGTTCCATCAGCGATGCAGAACACGCTACAAAATGTGCTCATTGCCGCAA CTAAAAGAAATTGCAACGTCACGCAGATGCGTGAACTGCCAACACTGGACTCAGCGACATTCAATGTCGAATGCTTTCGAAAATATGCATGTAATGACGAGTATTGGG AGGAGTTCGCTCGGAAGCCAATTAGGATTACCACTGAGTTTGTCACCGCATATGTAGCTAGACTGAAAGGCCCTAAGGCCGCCGCACTATTTGCAAAGACGTATAATT TGGTCCCATTGCAAGAAGTGCCTATGGATAGATTCGTCATGGACATGAAAAGAGACGTGAAAGTTACACCAGGCACGAAACACACAGAAGAAAGACCGAAAGTACAAG TGATACAAGCCGCAGAACCCCTGGCGACTGCTTACTTATGCGGGATTCACCGGGAATTAGTGCGTAGGCTTACGGCCGTCTTGCTTCCAAACATTCACACGCTTTTTG ACATGTCGGCGGAGGATTTTGATGCAATCATAGCAGAACACTTCAAGCAAGGCGACCCGGTACTGGAGACGGATATCGCATCATTCGACAAAAGCCAAGACGACGCTA TGGCGTTAACCGGTCTGATGATCTTGGAGGACCTGGGTGTGGATCAACCACTACTCGACTTGATCGAGTGCGCCTTTGGAGAAATATCATCCACCCATCTACCTACGG GTACTCGTTTTAAATTCGGGGCGATGATGAAATCCGGAATGTTCCTCACACTTTTTGTCAACACAGTTTTGAATGTCGTTATCGCCAGCAGAGTACTAGAAGAGCGGC TTAAAACGTCCAGATGTGCAGCGTTCATTGGCGACGACAACATCATACATGGAGTAGTATCTGACAAAGAAATGGCTGAGAGGTGCGCCACCTGGCTCAACATGGAGG TTAAGATCATCGACGCAGTCATCGGTGAGAGACCACCTTACTTCTGCGGCGGATTTATCTTGCAAGATTCGGTTACTTCCACAGCGTGCCGCGTGGCGGATCCCCTGA AAAGGCTGTTTAAGTTGGGTAAACCGCTCCCAGCCGACGACGAGCAAGACGAAGACAGAAGACGCGCTCTGCTAGATGAAACAAAGGCGTGGTTTAGAGTAGGTATAA CAGGCACTTTAGCAGTGGCCGTGACGACCCGGTATGAGGTAGACAATATTACACCTGTCCTACTGGCATTGAGAACTTTTGCCCAGAGCAAAAGAGCATTCCAAGCCA TCAGAGGGGAAATTAAAGCATCTCTACGGTGGTCCTAAATAGTCAGCATAGTACATTTCATCTGACTAATACCACAACACCACCACCTCTAGACCACCATGGTGAGCA AGGGCGAGGAGAATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGG GCCGCCCCTACGAGGCCTTTCAGACCGCTAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGG TCTACATTAAGCACCCAGCCGACATCCCCGACTACTTCAAGCTGTCCTTCCCCGAGGGCTTCAGGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCATTATTCACG TTAACCAGGACTCCTCCCTGCAGGACGGCGTGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCT GGGAGGCCTCCGAGGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGAGCGAGATCAAGAAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGCCGCCGAGGTCAAGA CCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGACATCAAGTTGGACATCGTGTCCCACAACGAGGACTACACCATCGTGGAACAGTACG AACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCCATGGCCGGGTGGAACGCCTACATCGACA GCCTTATGGCGGACGGGACCTGTCAGGACGCGGCCATCGTAGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAGACCTTCGTTAGCATTACGCCAG CTGAGGTTGGTGTCCTGGTAGGCAAAGACCGGTCAAGTTTTTTCGTCAATGGGCTGACACTTGGGGGCCAGAAATGTTCTGTGATCCGGGACTCACTGCTGCAAGACG GGGAATTTACAATGGATCTTCGTACCAAGAGCACCGGAGGAGCCCCCACCTTCAATGTCACTGTCACCATGACTGCCAAGACGCTAGTCCTGCTGATGGGCAAAGAAG GTGTCCACGGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCTCACCTGCGGCGTTCCCAGTACTAAACCGCATGCAGGCCTTAAAGCATCTCTACGGTGGTCC TAAATAGTCAGCATAGTACATTTCATCTGACTAATACCACAACACCACCACCTCTAGTAGAGGCGCACCATGGTGAGCAAGGGCGCCGAGCTGTTCACCGGCATCGTG CCCATCCTGATCGAGCTGAATGGCGATGTGAATGGCCACAAGTTCAGCGTGAGCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGC ACCACCGGCAAGCTGCCTGTGCCCTGGCCCACCCTGGTGACCACCCTGAGCTACGGCGTGCAGTGCTTCTCACGCTACCCCGATCACATGAAGCAGCACGACTTCTTC AAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACCATCTTCTTCGAGGATGACGGCAACTACAAGTCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTG AATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATGGCAACATCCTGGGCAATAAGATGGAGTACAACTACAACGCCCACAATGTGTACATCATGACCGACAAG GCCAAGAATGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGATGGCAGCGTGCAGCTGGCCGACCACTACCAGCAGAATACCCCCATCGGCGATGGCCCT GTGCTGCTGCCCGATAACCACTACCTGTCCACCCAGAGCGCCCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCC ATCACCCACGGCATGGATGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCC GGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGC GACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTAC AATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTC AACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTG CCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGC TTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCC CTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCC TGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCT GGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGC TCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGGGCCCAAT GATCCGACCAGCAAAACTCGATGTACTTCCGAGGAACTGATGTGCATAATGCATCAGGCTGGTACATTAGATCCCCGCTTACCGCGGGCAATATAGCAACACTAAAAA CTCGATGTACTTCCGAGGAAGCGCAGTGCATAATGTTGCGCAGTGTTGCCACATAACCACTATATTAACCATTTATTTAGCGGACGCCAAAAACTCAATGTATTTTTG AGGAAGCGTGGTGCATAATGCCACGCAGGTTTTGCATAATTTTTTTTTTTTTTTTTATTAATCAACAAAATTTTGTTTTTAACATTTCAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAGGGGAATTCCTCGATAATTAAGCGGCCGCTTAATTAATCGAGGGGAATTAATTCTTGAAGACGAAAGGGCCAGGTGGCACTTTTCGGGGAAATG TGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTA TGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATC AGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTC TGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGG AGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGC CTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGAC CACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGT CAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTT AACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAAC CACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGT AGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTA CCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGA GATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGC TTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAA ACGCCAGCAACGCGAGCTCGTATGGACATATTGTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGGGACACTATAG

TCTAGA

CCACC

ATGGTGAGCAAGGGCGAGGAGAATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGC GAGGGCGAGGGCCGCCCCTACGAGGCCTTTCAGACCGCTAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTAC GGCTCCAAGGTCTACATTAAGCACCCAGCCGACATCCCCGACTACTTCAAGCTGTCCTTCCCCGAGGGCTTCAGGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGC ATTATTCACGTTAACCAGGACTCCTCCCTGCAGGACGGCGTGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAG ACCATGGGCTGGGAGGCCTCCGAGGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGAGCGAGATCAAGAAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGCCGCC GAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGACATCAAGTTGGACATCGTGTCCCACAACGAGGACTACACCATCGTG GAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCCATGGCCGGGTGGAACGCC TACATCGACAGCCTTATGGCGGACGGGACCTGTCAGGACGCGGCCATCGTAGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAGACCTTCGTTAGC ATTACGCCAGCTGAGGTTGGTGTCCTGGTAGGCAAAGACCGGTCAAGTTTTTTCGTCAATGGGCTGACACTTGGGGGCCAGAAATGTTCTGTGATCCGGGACTCACTG CTGCAAGACGGGGAATTTACAATGGATCTTCGTACCAAGAGCACCGGAGGAGCCCCCACCTTCAATGTCACTGTCACCATGACTGCCAAGACGCTAGTCCTGCTGATG GGCAAAGAAGGTGTCCACGGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCTCACCTGCGGCGTTCCCAGTACTAA

ACC

GCATGC

AGGCCT

TAAAGCATCTCTACGGTGGTCCTAAATAGTCAGCATAGTACATTTCATCTGACTAATACCACAACACCACCACCTCTAG

TAGAGGCGCACC

ATGGTGAGCAAGGGCGCCGAGCTGTTCACCGGCATCGTGCCCATCCTGATCGAGCTGAATGGCGATGTGAATGGCCACAAGTTCAGCGTGAGCGGCGAGGGCGAGGGC GATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCTGTGCCCTGGCCCACCCTGGTGACCACCCTGAGCTACGGCGTGCAGTGCTTC TCACGCTACCCCGATCACATGAAGCAGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACCATCTTCTTCGAGGATGACGGCAACTACAAG TCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATGGCAACATCCTGGGCAATAAGATGGAGTAC AACTACAACGCCCACAATGTGTACATCATGACCGACAAGGCCAAGAATGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGATGGCAGCGTGCAGCTGGCC GACCACTACCAGCAGAATACCCCCATCGGCGATGGCCCTGTGCTGCTGCCCGATAACCACTACCTGTCCACCCAGAGCGCCCTGTCCAAGGACCCCAACGAGAAGCGC GATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCCATCACCCACGGCATGGATGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTATGGATGATGATATCGCC GCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGC GTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAAC TGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCC AACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGC ATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACT GACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGAC TTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCT GAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTAC GCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATT GCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGC CCCTCCATCGTCCACCGCAAATGCTTCTAG


GGGCCCAATGATCCGACCAGCAAAACTCGATGTACTTCCGAGGAACTGATGTGCATAATGCATCAGGCTGGTACATTAGATCCCCGCTTACCGCGGGCAATATAGCAA CACTAAAAACTCGATGTACTTCCGAGGAAGCGCAGTGCATAATGTTGCGCAGTGTTGCCACATAACCACTATATTAACCATTTATTTAGCGGACGCCAAAAACTCAAT GTATTTTTGAGGAAGCGTGGTGCATAATGCCACGCAGGTTTTGCATAATTTTTTTTTTTTTTTTTATTAATCAACAAAATTTTGTTTTTAACATTTC


AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


GGGGAATTCCTCGATAATTAAGCGGCCGCTTAATTAATCGAGGGGAATTAATTCTTGAAGACGAAAGGGCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCT ATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACAT TTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGA GTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCG GTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGAT GGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCA ACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCG GCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTA GTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTAC TCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCG TTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCG GTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGC CACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCA AGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGT GAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAAC GCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG AGCTCGTATGGACATATTGTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGGGACACTATAG