TYRO3P

From Bradwiki
Revision as of 03:27, 27 October 2017 by Bradley Monk (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

TYRO3P is a processed pseudogene for TYRO3.


{{#widget:Iframe

   |url=http://bradleymonk.com/wi/TYRO3_gene.html
   |width=1000
   |height=170
   |border=0

}}


BLAST

Here are the processed exons for TYRO3. If you run a CLICK HERE TO BLAST.


TYRO3 PROCESSED EXON SEQUENCE

GGGGTGACCCAGAGCACCATGTTTTCCTGTGAAGCTCACAACCTAAAAGGCCTGGCCTCTTCTCGCACAGCCACT
GTTCACCTTCAAGCACTGCCTGCAGCCCCCTTCAACATCACCGTGACAAAGCTTTCCAGCAGCAACGCTAGTGTG
GCCTGGATGCCAGGTGCTGATGGCCGAGCTCTGCTACAGTCCTGTACAGTTCAGGTGACACAGGCCCCAGGAGGC
TGGGAAGTCCTGGCTGTTGTGGTCCCTGTGCCCCCCTTTACCTGCCTGCTCCGGGACCTGGTGCCTGCCACCAAC
TACAGCCTCAGGGTGCGCTGTGCCAATGCCTTGGGGCCCTCTCCCTATGCTGACTGGGTGCCCTTTCAGACCAAG
GGTCTAGCCCCAGCCAGCGCTCCCCAAAACCTCCATGCCATCCGCACAGATTCAGGCCTCATCTTGGAGTGGGAA
GAAGTGATCCCCGAGGCCCCTTTGGAAGGCCCCCTGGGACCCTACAAACTGTCCTGGGTTCAAGACAATGGAACC
CAGGATGAGCTGACAGTGGAGGGGACCAGGGCCAATTTGACAGGCTGGGATCCCCAAAAGGACCTGATCGTACGT
GTGTGCGTCTCCAATGCAGTTGGCTGTGGACCCTGGAGTCAGCCACTGGTGGTCTCTTCTCATGACCGTGCAGGC
CAGCAGGGCCCTCCTCACAGCCGCACATCCTGGGTACCTGTGGTCCTTGGTGTGCTAACGGCCCTGGTGACGGCT
GCTGCCCTGGCCCTCATCCTGCTTCGAAAGAGACGGAAAGAGACGCGGTTTGGGCAAGCCTTTGACAGTGTCATG
GCCCGGGGAGAGCCAGCCGTTCACTTCCGGGCAGCCCGGTCCTTCAATCGAGAAAGGCCCGAGCGCATCGAGGCC
ACATTGGACAGCTTGGGCATCAGCGATGAACTAAAGGAAAAACTGGAGGATGTGCTCATCCCAGAGCAGCAGTTC
ACCCTGGGCCGGATGTTGGGCAAAGGAGAGTTTGGTTCAGTGCGGGAGGCCCAGCTGAAGCAAGAGGATGGCTCC
TTTGTGAAAGTGGCTGTGAAGATGCTGAAAGCTGACATCATTGCCTCAAGCGACATTGAAGAGTTCCTCAGGGAA
GCAGCTTGCATGAAGGAGTTTGACCATCCACACGTGGCCAAACTTGTTGGGGTAAGCCTCCGGAGCAGGGCTAAA
GGCCGTCTCCCCATCCCCATGGTCATCTTGCCCTTCATGAAGCATGGGGACCTGCATGCCTTCCTGCTCGCCTCC
CGGATTGGGGAGAACCCCTTTAACCTACCCCTCCAGACCCTGATCCGGTTCATGGTGGACATTGCCTGCGGCATG
GAGTACCTGAGCTCTCGGAACTTCATCCACCGAGACCTGGCTGCTCGGAATTGCATGCTGGCAGAGGACATGACA
GTGTGTGTGGCTGACTTCGGACTCTCCCGGAAGATCTACAGTGGGGACTACTATCGTCAAGGCTGTGCCTCCAAA
CTGCCTGTCAAGTGGCTGGCCCTGGAGAGCCTGGCCGACAACCTGTATACTGTGCAGAGTGACGTGTGGGCGTTC
GGGGTGACCATGTGGGAGATCATGACACGTGGGCAGACGCCATATGCTGGCATCGAAAACGCTGAGATTTACAAC
TACCTCATTGGCGGGAACCGCCTGAAACAGCCTCCGGAGTGTATGGAGGACGT


GGGGTGACCCAGAGCACCATGTTTTCCTGTGAAGCTCACAACCTAAAAGGCCTGGCCTCTTCTCGCACAGCCACTGTTCACCTTCAAG

CACTGCCTGCAGCCCCCTTCAACATCACCGTGACAAAGCTTTCCAGCAGCAACGCTAGTGTGGCCTGGATGCCAGGTGCTGATGGCCGAGCTCTGCTACAGTCCTGTACAGTTCAG

GTGACACAGGCCCCAGGAGGCTGGGAAGTCCTGGCTGTTGTGGTCCCTGTGCCCCCCTTTACCTGCCTGCTCCGGGACCTGGTGCCTGCCACCAACTACAGCCTCAGGGTGCGCTGTGCCAATGCCTTGGGGCCCTCTCCCTATGCTGACTGGGTGCCCTTTCAGACCAAGGGTCTAG

CCCCAGCCAGCGCTCCCCAAAACCTCCATGCCATCCGCACAGATTCAGGCCTCATCTTGGAGTGGGAAGAAGTGATCCCCGAGGCCCCTTTGGAAGGCCCCCTGGGACCCTACAAACTGTCCTGGGTTCAAGACAATGGAACCCAG

GATGAGCTGACAGTGGAGGGGACCAGGGCCAATTTGACAGGCTGGGATCCCCAAAAGGACCTGATCGTACGTGTGTGCGTCTCCAATGCAGTTGGCTGTGGACCCTGGAGTCAGCCACTGGTGGTCTCTTCTCATGACCGTGCAG

GCCAGCAGGGCCCTCCTCACAGCCGCACATCCTGGGTACCTGTGGTCCTTGGTGTGCTAACGGCCCTGGTGACGGCTGCTGCCCTGGCCCTCATCCTGCTTCGAAAGAGACGGAAAGAGACGCGGTTTGG

GCAAGCCTTTGACAGTGTCATGGCCCGGGGAGAGCCAGCCGTTCACTTCCGGGCAGCCCGGTCCTTCAATCGAGAAAGGCCCGAGCGCATCGAGGCCACAT

TGGACAGCTTGGGCATCAGCGATGAACTAAAGGAAAAACTGGAGGATGTGCTCATCCCAGAGCAGCAGTTCACCCTGGGCCGGATGTTGGGCAAAG

GAGAGTTTGGTTCAGTGCGGGAGGCCCAGCTGAAGCAAGAGGATGGCTCCTTTGTGAAAGTGGCTGTGAAGATGCTGAAAG

CTGACATCATTGCCTCAAGCGACATTGAAGAGTTCCTCAGGGAAGCAGCTTGCATGAAGGAGTTTGACCATCCACACGTGGCCAAACTTGTTG

GGGTAAGCCTCCGGAGCAGGGCTAAAGGCCGTCTCCCCATCCCCATGGTCATCTTGCCCTTCATGAAGCATGGGGACCTGCATGCCTTCCTGCTCGCCTCCCGGATTGGGGAGAACCCCTTT

AACCTACCCCTCCAGACCCTGATCCGGTTCATGGTGGACATTGCCTGCGGCATGGAGTACCTGAGCTCTCGGAACTTCATCCACCGAGACCTGGCTGCTCGGAATTGCAT

GCTGGCAGAGGACATGACAGTGTGTGTGGCTGACTTCGGACTCTCCCGGAAGATCTACAGTGGGGACTACTATCGTCAAGGCTGTGCCTCCAAACTGCCTGTCAAGTGGCTGGCCCTGGAGAGCCTGGCCGACAACCTGTATACTGTGCAGAGTGACGTG

TGGGCGTTCGGGGTGACCATGTGGGAGATCATGACACGTGGGCAGACGCCATATGCTGGCATCGAAAACGCTGAGATTTACAACTACCTCATTGGCGGGAACCGCCTGAAACAGCCTCCGGAGTGTATGGAGGACGT


see splice donor variant on dbSNP