APOE

ApoE status is defined by a person's combination of these two SNPs:

   SNP        CHR   POS(GRCh37)   POS(GRCh38)  REF   ALT   MUT
   rs429358   19    45411941      44908684     T     C     missense
   rs7412     19    45412079      44908822     C     T     missense

• rs429358
• rs7412

The rs429358 SNP is located in the fourth exon of the ApoE gene (19:45411941)^{(note this position is for reference genome GRCh37.p13)}, affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358-(T)-ref. If however (1) this loci has the alternate allele (rs429358-(C)-alt) and (2) nearby on the same chromosome the rs7412 loci harbors the common allele (rs7412-(C)-ref), the combination is known as APOE-ε4.

Various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4

   APOE ε2   |  rs429358( T ) + rs7412( T )
   
   APOE ε3   |  rs429358( T ) + rs7412( C )
   
   APOE ε4   |  rs429358( C ) + rs7412( C )

Combinations of BI-CHROMOSOMAL SNPs that constitute APOE alleles: ε2 ε3 ε4

   APOE STATUS (GRCh37 CHR19:POSITION) 		
   APOE 2	45411941 ( T )	45412079 ( T )
   APOE 3	45411941 ( T )	45412079 ( C )
   APOE 4	45411941 ( C )	45412079 ( C )

   APOE 2/2	45411941 ( T , T )	45412079 ( T , T )
   APOE 2/3	45411941 ( T , T )	45412079 ( T , C )
   APOE 2/4	45411941 ( T , C )	45412079 ( T , C )
   APOE 3/3	45411941 ( T , T )	45412079 ( C , C )
   APOE 3/4	45411941 ( T , C )	45412079 ( C , C )
   APOE 4/4	45411941 ( C , C )	45412079 ( C , C )

TABLES

---

APOE ε2 ε3 ε4 Allele Chromosomal Combinations

APOE STATUS	GRCh37 CHR19
ALLELE	POS	SNP1	SNP2	POS	SNP1	SNP2
APOE 2/2	45411941	T	T	45412079	T	T
APOE 2/3	45411941	T	T	45412079	T	C
APOE 2/4	45411941	T	C	45412079	T	C
APOE 3/3	45411941	T	T	45412079	C	C
APOE 3/4	45411941	T	C	45412079	C	C
APOE 4/4	45411941	C	C	45412079	C	C

	SNP	CHR	GRCh37.p13	GRCh38.p7	REF	ALT
	rs429358	19	45411941	44908684	T	C
	rs7412	19	45412079	44908822	C	T

SNP VIEWER

   GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG

''' SNP NAME        REFERENCE GENOME        POSITION   '''
    NC_000019.9  -- 45411941 GRCh37.p13 -- @19_45411941
    NC_000019.10 -- 44908684 GRCh38.p7  -- @19_45411941
    Variation ID:	rs429358
    Variant Type:	SNP, length 1
    Alleles:	    C/T

''' SNP NAME        REFERENCE GENOME        POSITION   '''
    NC_000019.9  -- 45412079 GRCh37.p13 -- @19_45412079
    NC_000019.10 -- 44908822 GRCh38.p7  -- @19_44908822
    Variation ID:	rs7412
    Variant Type:	SNP, length 1
    Alleles:	    C/T

ADDITIONAL RESOURCES

---

SNPedia

• GeneID: 348
• Name: apolipoprotein E
• MIMID: 107741
• EnsemblID: ENSG00000130203
• UniProtID: P02649

GNOMAD

Get more info about APOE variants on the GNOMAD database provided by a great team of genomics scientists at Broad institute.

For convenience, I've pulled the relevant AD-related APOE loci (along with several nearby flanking positions) from GNOMAD and pasted them into a datatable here:

view csv datatable.

SNPedia INFO

---

https://www.snpedia.com/index.php/APOE

The apolipoprotein E (ApoE) gene makes a protein which, when combined with fat, becomes a lipoprotein. The lipoprotein ApoE is a very low-density lipoprotein, responsible in part for removing cholesterol from the bloodstream. Variations in ApoE affect cholesterol metabolism, which in turn alter your chances of having heart disease and in particular a heart attack or a stroke. Variations in ApoE are also associated with altered odds of having Alzheimer's disease and other diseases.

There are three relatively common allelic variants of ApoE, as defined by two SNPs, rs429358 and rs7412 known as ApoE-ε2, ApoE-ε3, and ApoE-ε4. The proteins produced by these genes are called ApoE2, ApoE3, and ApoE4. The most common variant overall is the "standard" ApoE-ε3, and therefore more people inherited one ApoE-ε3 from each parent than any other of the possible pairs of variants. Note that each of these types can actually have additional changes too, so there are different subtypes as well.

rs429358	rs7412	Name
C	T	ε1
T	T	ε2
T	C	ε3
C	C	ε4

• Apo-ε1/ε1 gs267 rs429358(C;C) rs7412(T;T) the rare missing allele
• Apo-ε1/ε2 gs271 (C;T) (T;T)
• Apo-ε1/ε3 gs270 (C;T) (C;T) ambiguous with ε2/ε4
• Apo-ε1/ε4 gs272 (C;C) (C;T)
• Apo-ε2/ε2 gs268 (T;T) (T;T)
• Apo-ε2/ε3 gs269 (T;T) (C;T)
• Apo-ε2/ε4 gs270 (C;T) (C;T) ambiguous with ε1/ε3
• Apo-ε3/ε3 gs246 (T;T) (C;C) the most common
• Apo-ε3/ε4 gs141 (C;T) (C;C)
• Apo-ε4/ε4 gs216 (C;C) (C;C) ~11x increased Alzheimer's risk

Allele specific genosets gs189 and gs188 were previously used, but have now been replaced by the genotype specific ones shown above.

One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.

Word of caution to those with data from Ancestry.com: in our experience, based on data in OpenSNP and from Promethease users since 2006, Ancestry data always reports rs429358 as (T;T), even for people who's data from other sources indicates they are (C;T). Therefore, until Ancestry corrects this false negative problem, be aware that the ApoE genosets defined by the genotypes listed above (and therefore assigned by Promethease) will be inaccurate if they are based on (inaccurate) Ancestry data. Specifically, some percentage of Ancestry users who are supposedly gs246 positive (Apo-ε3/ε3) are actually either gs141 (Apo-ε3/ε4) or gs216 (Apo-ε4/ε4).

Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus predictive of it, as published in the following report:

• [PMID 17192785] The researchers found that on testing DNA samples from 1,086 well-characterized Alzheimer's disease cases, a single SNP (rs4420638) lying 14 kb distal to the ApoE locus has a powerful association with late-onset AD (corrected p value was 5.3 x 10 e-34). No other SNP showed as robust an association. The authors estimated that people with two ApoE-ε4 copies (i.e. presumably indicated by having either the rs4420638(G;G) or rs429358(C;C) genotypes) have a 25-fold increased risk for developing the disease compared to Apo-ε3/Apo-ε3 carriers.

APOE-ε4 carriers may have their risk of developing Alzheimer's disease modified by SNPs elsewhere in their genomes. For example:

• rs2373115, a SNP in the GAB2 gene
• Inheritance of the rs1799724(T) allele appears to synergistically increase the risk of Alzheimer's in ApoE-ε4 carriers and is associated with altered CSF Abeta42 levels [PMID 15895461]
• A haplotype of 3 SNPs in the POLD1 gene; the combined presence of this POLD1 I-G-T haplotype and the ApoE-ε4 allele almost doubles the risk of AD (odds ratio: 10.09, CI: 3.88-26.25, =<0.0001) compared to ApoE-ε4 carriers alone.[PMID 17498878]

A study of 2,000+ individuals living in Costa Rica found a gene-diet interaction involving the ApoE alleles. Specifically, high fat diets cause a greater LDL cholesterol response and higher heart attack risk in ApoE-ε2 and ApoE-ε4 carriers compared with ApoE-ε3 homozygotes.[PMID 18494374]

abstract ApoE-ε4 and herpes simplex virus type 1 appear related to the development of Alzheimer's disease.