APOE

	GRCh	SNP	CHR	LOC	REF	ALT
	GRCh37.p13	rs429358	19	45411941	T	C
	GRCh38.p7	rs429358	19	45411941	T	C
	GRCh37.p13	rs429358	19	45411941	T	C
	GRCh38.p7	rs429358	19	45411941	T	C

GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG

SNP Alleles

There are two SNP that contribute to the APOE profile

rs429358 SNP, located in the fourth exon of the ApoE gene, affects the amino acid at position 130 of the resulting protein. The more common rs429358 allele is (T). If the allele is (C) and the same chromosome also harbors the rs7412 (C) allele, the combination is known as an APOE-ε4 allele. The APOE-ε4 allele has a strong influence on the risk of Alzheimer's disease. Both deCODEme and 23andMe (v3 chip) test for this SNP.

https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs7412

REF ALT SNP T C rs7412

	REF	ALT
rs429358	T	C
rs7412	C	G
Example	Example	Example

Many studies have estimated the level of risk, and it varies depending on age, sex, ethnicity, and other factors. One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. [PMID 10325447]

Meta-analyses have also supported the association between the APOE-ε4 allele and somewhat increased risk for heart disease, with an odds ratio of 1.42 (CI: 1.26 - 1.61).[15488874?dopt=Abstract PMID 15488874]

Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.

Genomic locations: chr19:45411941 NC_000019.9 @ 45411941 @GRCh37.p13

NC_000019.10 @ 44908684 @GRCh38.p7 Variation ID: rs429358 Variant Type: SNP, length 1 Alleles: C/T