APOE: Difference between revisions
Bradley Monk (talk | contribs) No edit summary |
Bradley Monk (talk | contribs) No edit summary |
||
| Line 8: | Line 8: | ||
| || rs429358 || 19 || 45411941 || 44908684 || T || C | | || rs429358 || 19 || 45411941 || 44908684 || T || C | ||
|- | |- | ||
| || rs7412 || 19 || 45412079 || 44908822 || | | || rs7412 || 19 || 45412079 || 44908822 || C || T | ||
|} | |} | ||
[https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε2] | rs429358( T ) + rs7412( T ) | |||
[https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε3] | rs429358( T ) + rs7412( C ) | |||
[https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε4] | rs429358( C ) + rs7412( C ) | |||
Revision as of 22:48, 16 December 2017
| SNP | CHR | GRCh37.p13 | GRCh38.p7 | REF | ALT | |
|---|---|---|---|---|---|---|
| rs429358 | 19 | 45411941 | 44908684 | T | C | |
| rs7412 | 19 | 45412079 | 44908822 | C | T |
APOE ε2 | rs429358( T ) + rs7412( T ) APOE ε3 | rs429358( T ) + rs7412( C ) APOE ε4 | rs429358( C ) + rs7412( C )
SNP Alleles
There are two SNP that contribute to the APOE profile
rs429358 SNP, located in the fourth exon of the ApoE gene, affects the amino acid at position 130 of the resulting protein. The more common rs429358 allele is (T). If the allele is (C) and the same chromosome also harbors the rs7412 (C) allele, the combination is known as an APOE-ε4 allele. The APOE-ε4 allele has a strong influence on the risk of Alzheimer's disease. Both deCODEme and 23andMe (v3 chip) test for this SNP.
https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs7412
Many studies have estimated the level of risk, and it varies depending on age, sex, ethnicity, and other factors. One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. [PMID 10325447]
Meta-analyses have also supported the association between the APOE-ε4 allele and somewhat increased risk for heart disease, with an odds ratio of 1.42 (CI: 1.26 - 1.61).[15488874?dopt=Abstract PMID 15488874]
Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.
SNP DETAILS
SNP NAME GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG NC_000019.9 @ 45411941 @GRCh37.p13 : 19:45411941 NC_000019.10 @ 44908684 @GRCh38.p7 : 19:45411941 Variation ID: rs429358 Variant Type: SNP, length 1 Alleles: C/T
SNP NAME NC_000019.9 @ 45412079 @GRCh37.p13 : 19:45412079 NC_000019.10 @ 44908822 @GRCh38.p7 : 19:44908822 Variation ID: rs7412 Variant Type: SNP, length 1 Alleles: C/T