APOE: Difference between revisions

From bradwiki
Jump to navigation Jump to search
No edit summary
No edit summary
Line 1: Line 1:


ApoE status is defined by these two SNPs:
* [https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs429358 rs429358]
* [https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs7412 rs7412]


'''rs429358''' is located in the fourth exon of the ApoE gene ([https://goo.gl/Ufsm1y 19:45411941]), affects the amino acid at position 130 of the resulting protein; the more common allele is '''rs429358(T)(ref)'''. If this allele is '''rs429358(C)(alt)''' and the same chromosome also harbors '''rs7412(C)(ref)''' allele, the combination is known as an APOE-ε4 allele.


{| class="wikitable"
Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4
|-
! !! SNP !! CHR !! GRCh37.p13 !! GRCh38.p7 !! REF !! ALT
|-
| || rs429358 || 19 || 45411941 || 44908684 || T || C
|-
| || rs7412    || 19 || 45412079 || 44908822 || C || T
|}






     [https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε2]  |  rs429358( T ) + rs7412( T )
     [https://www.snpedia.com/index.php/Rs429358 APOE ε2]  |  rs429358( T ) + rs7412( T )
      
      
     [https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε3]  |  rs429358( T ) + rs7412( C )
     [https://www.snpedia.com/index.php/Rs429358 APOE ε3]  |  rs429358( T ) + rs7412( C )
      
      
     [https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε4]  |  rs429358( C ) + rs7412( C )
     [https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε4]  |  rs429358( C ) + rs7412( C )




== GENOMIC LOCATIONS ==


{| class="wikitable"
|-
! !! SNP !! CHR !! GRCh37.p13 !! GRCh38.p7 !! REF !! ALT
|-
| || rs429358 || 19 || 45411941 || 44908684 || T  || C
|-
| || rs7412    || 19 || 45412079 || 44908822 || C  || T
|}








== MORE DETAILS ==


One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.


==SNP Alleles==
There are two SNP that contribute to the APOE profile
[https://www.snpedia.com/index.php/Rs429358 rs429358] SNP, located in the fourth exon of the ApoE gene, affects the amino acid at position 130 of the resulting protein. The more common rs429358 allele is (T). If the allele is (C) and the same chromosome also harbors the [https://www.snpedia.com/index.php/rs7412 rs7412] (C) allele, the combination is known as an APOE-ε4 allele. The APOE-ε4 allele has a strong influence on the risk of Alzheimer's disease. Both deCODEme and 23andMe (v3 chip) test for this SNP.
https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs7412
Many studies have estimated the level of risk, and it varies depending on age, sex, ethnicity, and other factors. One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. [PMID 10325447]
Meta-analyses have also supported the association between the APOE-ε4 allele and somewhat increased risk for heart disease, with an odds ratio of 1.42 (CI: 1.26 - 1.61).[15488874?dopt=Abstract PMID 15488874]
Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.
== SNP DETAILS ==


[https://www.ncbi.nlm.nih.gov/variation/view/ VIEWER]
[https://www.ncbi.nlm.nih.gov/variation/view/ VIEWER]

Revision as of 23:02, 16 December 2017

ApoE status is defined by these two SNPs:

rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.

Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4 


   APOE ε2   |  rs429358( T ) + rs7412( T )
   
   APOE ε3   |  rs429358( T ) + rs7412( C )
   
   APOE ε4   |  rs429358( C ) + rs7412( C )


GENOMIC LOCATIONS

SNP CHR GRCh37.p13 GRCh38.p7 REF ALT
rs429358 19 45411941 44908684 T C
rs7412 19 45412079 44908822 C T



MORE DETAILS

One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.


VIEWER 


   SNP NAME 
   GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG
   NC_000019.9  @ 45411941 @GRCh37.p13 : 19:45411941
   NC_000019.10 @ 44908684 @GRCh38.p7  : 19:45411941
   Variation ID:	rs429358
   Variant Type:	SNP, length 1
   Alleles:	    C/T



   SNP NAME
   NC_000019.9  @ 45412079 @GRCh37.p13 : 19:45412079
   NC_000019.10 @ 44908822 @GRCh38.p7  : 19:44908822
   Variation ID:	rs7412
   Variant Type:	SNP, length 1
   Alleles:	    C/T
Retrieved from "https://bradleymonk.com/wiki/index.php?title=APOE&oldid=3395"