APOE: Difference between revisions
Bradley Monk (talk | contribs) No edit summary |
Bradley Monk (talk | contribs) No edit summary |
||
| Line 15: | Line 15: | ||
[https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε4] | rs429358( C ) + rs7412( C ) | [https://www.snpedia.com/index.php/APOE-%CE%B54 APOE ε4] | rs429358( C ) + rs7412( C ) | ||
APOE STATUS (GRCh37 CHR19:POSITION) | |||
APOE 2 45411941 ( T ) 45412079 ( T ) | |||
APOE 3 45411941 ( T ) 45412079 ( C ) | |||
APOE 4 45411941 ( C ) 45412079 ( C ) | |||
APOE 2/2 45411941 ( T , T ) 45412079 ( T , T ) | |||
APOE 2/3 45411941 ( T , T ) 45412079 ( T , C ) | |||
APOE 2/4 45411941 ( T , C ) 45412079 ( T , C ) | |||
APOE 3/3 45411941 ( T , T ) 45412079 ( C , C ) | |||
APOE 3/4 45411941 ( T , C ) 45412079 ( C , C ) | |||
APOE 4/4 45411941 ( C , C ) 45412079 ( C , C ) | |||
| Line 56: | Line 68: | ||
Variant Type: SNP, length 1 | Variant Type: SNP, length 1 | ||
Alleles: C/T | Alleles: C/T | ||
{| class="wikitable" width=100% border=1 cellspacing=15px cellpadding=50px style="background:white;color:firebrick;border: 1px solid gray;" | |||
|+ style="font-weight:bold;"|Doctorates Awarded by State and Sex | |||
|- | |||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black"| APOE STATUS | |||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | GRCh37 | |||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | CHR19 | |||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | POSITION | |||
|- | |||
! ALLELE | |||
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| POS | |||
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1 | |||
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2 | |||
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| POS | |||
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1 | |||
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2 | |||
|- align=right | |||
! style="padding:10px; | APOE 2/2 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|- align=center | |||
! style="padding:10px; | APOE 2/3 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|- align=right | |||
! APOE 2/4 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|- align=right | |||
! APOE 3/3 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|- align=right | |||
! APOE 3/4 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|- align=right | |||
! APOE 4/4 | |||
| 45411941 || T || T || 45412079 || T || T | |||
|} | |||
Revision as of 05:56, 17 December 2017
ApoE status is defined by these two SNPs:
rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.
Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4
APOE ε2 | rs429358( T ) + rs7412( T ) APOE ε3 | rs429358( T ) + rs7412( C ) APOE ε4 | rs429358( C ) + rs7412( C )
APOE STATUS (GRCh37 CHR19:POSITION)
APOE 2 45411941 ( T ) 45412079 ( T )
APOE 3 45411941 ( T ) 45412079 ( C )
APOE 4 45411941 ( C ) 45412079 ( C )
APOE 2/2 45411941 ( T , T ) 45412079 ( T , T )
APOE 2/3 45411941 ( T , T ) 45412079 ( T , C )
APOE 2/4 45411941 ( T , C ) 45412079 ( T , C )
APOE 3/3 45411941 ( T , T ) 45412079 ( C , C )
APOE 3/4 45411941 ( T , C ) 45412079 ( C , C )
APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )
GENOMIC LOCATIONS
| SNP | CHR | GRCh37.p13 | GRCh38.p7 | REF | ALT | |
|---|---|---|---|---|---|---|
| rs429358 | 19 | 45411941 | 44908684 | T | C | |
| rs7412 | 19 | 45412079 | 44908822 | C | T |
MORE DETAILS
One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.
SNP NAME GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG NC_000019.9 @ 45411941 @GRCh37.p13 : 19:45411941 NC_000019.10 @ 44908684 @GRCh38.p7 : 19:45411941 Variation ID: rs429358 Variant Type: SNP, length 1 Alleles: C/T
SNP NAME NC_000019.9 @ 45412079 @GRCh37.p13 : 19:45412079 NC_000019.10 @ 44908822 @GRCh38.p7 : 19:44908822 Variation ID: rs7412 Variant Type: SNP, length 1 Alleles: C/T
| APOE STATUS | GRCh37 | CHR19 | POSITION | |||
|---|---|---|---|---|---|---|
| ALLELE | POS | SNP1 | SNP2 | POS | SNP1 | SNP2 |
| APOE 2/2 | 45411941 | T | T | 45412079 | T | T |
| APOE 2/3 | 45411941 | T | T | 45412079 | T | T |
| APOE 2/4 | 45411941 | T | T | 45412079 | T | T |
| APOE 3/3 | 45411941 | T | T | 45412079 | T | T |
| APOE 3/4 | 45411941 | T | T | 45412079 | T | T |
| APOE 4/4 | 45411941 | T | T | 45412079 | T | T |