APOE: Difference between revisions

From bradwiki
Jump to navigation Jump to search
No edit summary
No edit summary
Line 83: Line 83:
|+ style="font-weight:bold;"|Doctorates Awarded by State and Sex
|+ style="font-weight:bold;"|Doctorates Awarded by State and Sex
|-  
|-  
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black"| APOE STATUS
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="1" | APOE STATUS
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | GRCh37
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | GRCh37
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | CHR19
   ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | CHR19:POSITION
  ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="2" | POSITION  
|-
|-
! ALLELE
! ALLELE
Line 98: Line 97:
! style="padding:10px; | APOE 2/2
! style="padding:10px; | APOE 2/2
| 45411941 || T  || T || 45412079 || T || T
| 45411941 || T  || T || 45412079 || T || T
|- align=center
|- align=right
! style="padding:10px; | APOE 2/3
! style="padding:10px; | APOE 2/3
| 45411941 || T  || T || 45412079 || T || T
| 45411941 || T  || T || 45412079 || T || C
|- align=right
|- align=right
! APOE 2/4
! style="padding:10px; | APOE 2/4
| 45411941 || T  || T || 45412079 || T || T
| 45411941 || T  || C || 45412079 || T || C
|- align=right
|- align=right
! APOE 3/3
! style="padding:10px; | APOE 3/3
| 45411941 || T  || T || 45412079 || T || T
| 45411941 || T  || T || 45412079 || C || C
|- align=right
|- align=right
! APOE 3/4
! style="padding:10px; | APOE 3/4
| 45411941 || T  || T || 45412079 || T || T
| 45411941 || T  || C || 45412079 || C || C
|- align=right
|- align=right
! APOE 4/4
! style="padding:10px; | APOE 4/4
| 45411941 || T || T || 45412079 || T || T
| 45411941 || C || C || 45412079 || C || C
|}
|}

Revision as of 06:00, 17 December 2017

ApoE status is defined by these two SNPs:

rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.

Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4


   APOE ε2   |  rs429358( T ) + rs7412( T )
   
   APOE ε3   |  rs429358( T ) + rs7412( C )
   
   APOE ε4   |  rs429358( C ) + rs7412( C )


APOE STATUS (GRCh37 CHR19:POSITION) APOE 2 45411941 ( T ) 45412079 ( T ) APOE 3 45411941 ( T ) 45412079 ( C ) APOE 4 45411941 ( C ) 45412079 ( C ) APOE 2/2 45411941 ( T , T ) 45412079 ( T , T ) APOE 2/3 45411941 ( T , T ) 45412079 ( T , C ) APOE 2/4 45411941 ( T , C ) 45412079 ( T , C ) APOE 3/3 45411941 ( T , T ) 45412079 ( C , C ) APOE 3/4 45411941 ( T , C ) 45412079 ( C , C ) APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )


GENOMIC LOCATIONS


SNP CHR GRCh37.p13 GRCh38.p7 REF ALT
rs429358 19 45411941 44908684 T C
rs7412 19 45412079 44908822 C T



MORE DETAILS


One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.


VIEWER


   SNP NAME 
   GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG
   NC_000019.9  @ 45411941 @GRCh37.p13 : 19:45411941
   NC_000019.10 @ 44908684 @GRCh38.p7  : 19:45411941
   Variation ID:	rs429358
   Variant Type:	SNP, length 1
   Alleles:	    C/T


   SNP NAME
   NC_000019.9  @ 45412079 @GRCh37.p13 : 19:45412079
   NC_000019.10 @ 44908822 @GRCh38.p7  : 19:44908822
   Variation ID:	rs7412
   Variant Type:	SNP, length 1
   Alleles:	    C/T







Doctorates Awarded by State and Sex
APOE STATUS GRCh37 CHR19:POSITION
ALLELE POS SNP1 SNP2 POS SNP1 SNP2
APOE 2/2 45411941 T T 45412079 T T
APOE 2/3 45411941 T T 45412079 T C
APOE 2/4 45411941 T C 45412079 T C
APOE 3/3 45411941 T T 45412079 C C
APOE 3/4 45411941 T C 45412079 C C
APOE 4/4 45411941 C C 45412079 C C