APOE: Difference between revisions
Bradley Monk (talk | contribs) No edit summary |
Bradley Monk (talk | contribs) No edit summary |
||
Line 83: | Line 83: | ||
|+ style="font-weight:bold;"|Doctorates Awarded by State and Sex | |+ style="font-weight:bold;"|Doctorates Awarded by State and Sex | ||
|- | |- | ||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black"| APOE STATUS | ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="1" | APOE STATUS | ||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan=" | ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | GRCh37 | ||
! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan=" | ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | CHR19:POSITION | ||
|- | |- | ||
! ALLELE | ! ALLELE | ||
Line 98: | Line 97: | ||
! style="padding:10px; | APOE 2/2 | ! style="padding:10px; | APOE 2/2 | ||
| 45411941 || T || T || 45412079 || T || T | | 45411941 || T || T || 45412079 || T || T | ||
|- align= | |- align=right | ||
! style="padding:10px; | APOE 2/3 | ! style="padding:10px; | APOE 2/3 | ||
| 45411941 || T || T || 45412079 || T || | | 45411941 || T || T || 45412079 || T || C | ||
|- align=right | |- align=right | ||
! APOE 2/4 | ! style="padding:10px; | APOE 2/4 | ||
| 45411941 || T || | | 45411941 || T || C || 45412079 || T || C | ||
|- align=right | |- align=right | ||
! APOE 3/3 | ! style="padding:10px; | APOE 3/3 | ||
| 45411941 || T || T || 45412079 || | | 45411941 || T || T || 45412079 || C || C | ||
|- align=right | |- align=right | ||
! APOE 3/4 | ! style="padding:10px; | APOE 3/4 | ||
| 45411941 || T || | | 45411941 || T || C || 45412079 || C || C | ||
|- align=right | |- align=right | ||
! APOE 4/4 | ! style="padding:10px; | APOE 4/4 | ||
| 45411941 || | | 45411941 || C || C || 45412079 || C || C | ||
|} | |} |
Revision as of 06:00, 17 December 2017
ApoE status is defined by these two SNPs:
rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.
Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4
APOE ε2 | rs429358( T ) + rs7412( T ) APOE ε3 | rs429358( T ) + rs7412( C ) APOE ε4 | rs429358( C ) + rs7412( C )
APOE STATUS (GRCh37 CHR19:POSITION)
APOE 2 45411941 ( T ) 45412079 ( T )
APOE 3 45411941 ( T ) 45412079 ( C )
APOE 4 45411941 ( C ) 45412079 ( C )
APOE 2/2 45411941 ( T , T ) 45412079 ( T , T )
APOE 2/3 45411941 ( T , T ) 45412079 ( T , C )
APOE 2/4 45411941 ( T , C ) 45412079 ( T , C )
APOE 3/3 45411941 ( T , T ) 45412079 ( C , C )
APOE 3/4 45411941 ( T , C ) 45412079 ( C , C )
APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )
GENOMIC LOCATIONS
SNP | CHR | GRCh37.p13 | GRCh38.p7 | REF | ALT | |
---|---|---|---|---|---|---|
rs429358 | 19 | 45411941 | 44908684 | T | C | |
rs7412 | 19 | 45412079 | 44908822 | C | T |
MORE DETAILS
One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.
SNP NAME GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG NC_000019.9 @ 45411941 @GRCh37.p13 : 19:45411941 NC_000019.10 @ 44908684 @GRCh38.p7 : 19:45411941 Variation ID: rs429358 Variant Type: SNP, length 1 Alleles: C/T
SNP NAME NC_000019.9 @ 45412079 @GRCh37.p13 : 19:45412079 NC_000019.10 @ 44908822 @GRCh38.p7 : 19:44908822 Variation ID: rs7412 Variant Type: SNP, length 1 Alleles: C/T
APOE STATUS | GRCh37 | CHR19:POSITION | ||||
---|---|---|---|---|---|---|
ALLELE | POS | SNP1 | SNP2 | POS | SNP1 | SNP2 |
APOE 2/2 | 45411941 | T | T | 45412079 | T | T |
APOE 2/3 | 45411941 | T | T | 45412079 | T | C |
APOE 2/4 | 45411941 | T | C | 45412079 | T | C |
APOE 3/3 | 45411941 | T | T | 45412079 | C | C |
APOE 3/4 | 45411941 | T | C | 45412079 | C | C |
APOE 4/4 | 45411941 | C | C | 45412079 | C | C |