APOE: Difference between revisions

From bradwiki
Jump to navigation Jump to search
No edit summary
No edit summary
Line 6: Line 6:
'''rs429358''' is located in the fourth exon of the ApoE gene ([https://goo.gl/Ufsm1y 19:45411941]), affects the amino acid at position 130 of the resulting protein; the more common allele is '''rs429358(T)(ref)'''. If this allele is '''rs429358(C)(alt)''' and the same chromosome also harbors '''rs7412(C)(ref)''' allele, the combination is known as an APOE-ε4 allele.
'''rs429358''' is located in the fourth exon of the ApoE gene ([https://goo.gl/Ufsm1y 19:45411941]), affects the amino acid at position 130 of the resulting protein; the more common allele is '''rs429358(T)(ref)'''. If this allele is '''rs429358(C)(alt)''' and the same chromosome also harbors '''rs7412(C)(ref)''' allele, the combination is known as an APOE-ε4 allele.


Here are the various combinations of SNPs that constitute APOE alleles: ε2  ε3  ε4


    SNP        CHR  POS(GRCh37)  POS(GRCh38)  REF  ALT
    rs429358  19    45411941      44908684    T    C
    rs7412    19    45412079      44908822    C    T


Various combinations of SNPs that constitute APOE alleles: ε2  ε3  ε4


     [https://www.snpedia.com/index.php/Rs429358 APOE ε2]  |  rs429358( T ) + rs7412( T )
     [https://www.snpedia.com/index.php/Rs429358 APOE ε2]  |  rs429358( T ) + rs7412( T )
Line 17: Line 20:




APOE STATUS (GRCh37 CHR19:POSITION)
Combinations of BI-CHROMOSOMAL SNPs that constitute APOE alleles: ε2  ε3  ε4
APOE 2 45411941 ( T ) 45412079 ( T )
 
APOE 3 45411941 ( T ) 45412079 ( C )
    APOE STATUS (GRCh37 CHR19:POSITION)
APOE 4 45411941 ( C ) 45412079 ( C )
    APOE 2 45411941 ( T ) 45412079 ( T )
APOE 2/2 45411941 ( T , T ) 45412079 ( T , T )
    APOE 3 45411941 ( T ) 45412079 ( C )
APOE 2/3 45411941 ( T , T ) 45412079 ( T , C )
    APOE 4 45411941 ( C ) 45412079 ( C )
APOE 2/4 45411941 ( T , C ) 45412079 ( T , C )
    APOE 2/2 45411941 ( T , T ) 45412079 ( T , T )
APOE 3/3 45411941 ( T , T ) 45412079 ( C , C )
    APOE 2/3 45411941 ( T , T ) 45412079 ( T , C )
APOE 3/4 45411941 ( T , C ) 45412079 ( C , C )
    APOE 2/4 45411941 ( T , C ) 45412079 ( T , C )
APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )
    APOE 3/3 45411941 ( T , T ) 45412079 ( C , C )
    APOE 3/4 45411941 ( T , C ) 45412079 ( C , C )
    APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )
 
 
{| class="wikitable" width=100% border=1 cellspacing=5px cellpadding=30px style="background:white;color:firebrick;border: 1px solid gray;"
|+ style="font-weight:bold;"|APOE ε2  ε3  ε4 Allele Chromosomal Combinations
|-
  ! style="padding:15px;background:brown;color:white;border-bottom:1.5px solid black" colspan="1" | APOE STATUS
  ! style="padding:15px;background:brown;color:white;border-bottom:1.5px solid black" colspan="6" | GRCh37 CHR19
|-
! style="padding:10px;background:brown;color:white;"| ALLELE
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| POS
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| POS
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2
|- align=right
! style="padding:5px; | APOE 2/2
| 45411941 || T  || T || 45412079 || T || T
|- align=right
! style="padding:5px; | APOE 2/3
| 45411941 || T  || T || 45412079 || T || C
|- align=right
! style="padding:5px; | APOE 2/4
| 45411941 || T  || C || 45412079 || T || C
|- align=right
! style="padding:5px; | APOE 3/3
| 45411941 || T  || T || 45412079 || C || C
|- align=right
! style="padding:5px; | APOE 3/4
| 45411941 || T  || C || 45412079 || C || C
|- align=right
! style="padding:5px; | APOE 4/4
| 45411941 || C  || C || 45412079 || C || C
|}
 
 
 




Line 68: Line 110:
     Variant Type: SNP, length 1
     Variant Type: SNP, length 1
     Alleles:     C/T
     Alleles:     C/T
{| class="wikitable" width=100% border=1 cellspacing=15px cellpadding=50px style="background:white;color:firebrick;border: 1px solid gray;"
|+ style="font-weight:bold;"|Doctorates Awarded by State and Sex
|-
  ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="1" | APOE STATUS
  ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | GRCh37
  ! style="padding:25px;background:brown;color:white;border-bottom:1.5px solid black" colspan="3" | CHR19:POSITION
|-
! ALLELE
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| POS
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1
| style="padding:5px;background:#faffd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| POS
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP1
| style="padding:5px;background:#ffefd5;color:black;border-bottom:2.0px solid gray" align=center| SNP2
|- align=right
! style="padding:10px; | APOE 2/2
| 45411941 || T  || T || 45412079 || T || T
|- align=right
! style="padding:10px; | APOE 2/3
| 45411941 || T  || T || 45412079 || T || C
|- align=right
! style="padding:10px; | APOE 2/4
| 45411941 || T  || C || 45412079 || T || C
|- align=right
! style="padding:10px; | APOE 3/3
| 45411941 || T  || T || 45412079 || C || C
|- align=right
! style="padding:10px; | APOE 3/4
| 45411941 || T  || C || 45412079 || C || C
|- align=right
! style="padding:10px; | APOE 4/4
| 45411941 || C  || C || 45412079 || C || C
|}

Revision as of 06:13, 17 December 2017

ApoE status is defined by these two SNPs:

rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele. 


   SNP        CHR   POS(GRCh37)   POS(GRCh38)  REF   ALT
   rs429358   19    45411941      44908684     T     C
   rs7412     19    45412079      44908822     C     T

Various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4 

   APOE ε2   |  rs429358( T ) + rs7412( T )
   
   APOE ε3   |  rs429358( T ) + rs7412( C )
   
   APOE ε4   |  rs429358( C ) + rs7412( C )


Combinations of BI-CHROMOSOMAL SNPs that constitute APOE alleles: ε2 ε3 ε4 

   APOE STATUS (GRCh37 CHR19:POSITION) 		
   APOE 2	45411941 ( T )	45412079 ( T )
   APOE 3	45411941 ( T )	45412079 ( C )
   APOE 4	45411941 ( C )	45412079 ( C )
   APOE 2/2	45411941 ( T , T )	45412079 ( T , T )
   APOE 2/3	45411941 ( T , T )	45412079 ( T , C )
   APOE 2/4	45411941 ( T , C )	45412079 ( T , C )
   APOE 3/3	45411941 ( T , T )	45412079 ( C , C )
   APOE 3/4	45411941 ( T , C )	45412079 ( C , C )
   APOE 4/4	45411941 ( C , C )	45412079 ( C , C )


APOE ε2 ε3 ε4 Allele Chromosomal Combinations
APOE STATUS GRCh37 CHR19
ALLELE POS SNP1 SNP2 POS SNP1 SNP2
APOE 2/2 45411941 T T 45412079 T T
APOE 2/3 45411941 T T 45412079 T C
APOE 2/4 45411941 T C 45412079 T C
APOE 3/3 45411941 T T 45412079 C C
APOE 3/4 45411941 T C 45412079 C C
APOE 4/4 45411941 C C 45412079 C C



GENOMIC LOCATIONS

SNP CHR GRCh37.p13 GRCh38.p7 REF ALT
rs429358 19 45411941 44908684 T C
rs7412 19 45412079 44908822 C T



MORE DETAILS

One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.


VIEWER 


   SNP NAME 
   GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG
   NC_000019.9  @ 45411941 @GRCh37.p13 : 19:45411941
   NC_000019.10 @ 44908684 @GRCh38.p7  : 19:45411941
   Variation ID:	rs429358
   Variant Type:	SNP, length 1
   Alleles:	    C/T



   SNP NAME
   NC_000019.9  @ 45412079 @GRCh37.p13 : 19:45412079
   NC_000019.10 @ 44908822 @GRCh38.p7  : 19:44908822
   Variation ID:	rs7412
   Variant Type:	SNP, length 1
   Alleles:	    C/T
Retrieved from "https://bradleymonk.com/wiki/index.php?title=APOE&oldid=3399"