APOE
ApoE status is defined by these two SNPs:
rs429358 is located in the fourth exon of the ApoE gene (19:45411941)(note this position is for reference genome GRCh37.p13), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.
SNP CHR POS(GRCh37) POS(GRCh38) REF ALT MUT rs429358 19 45411941 44908684 T C missense rs7412 19 45412079 44908822 C T missense
Various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4
APOE ε2 | rs429358( T ) + rs7412( T ) APOE ε3 | rs429358( T ) + rs7412( C ) APOE ε4 | rs429358( C ) + rs7412( C )
Combinations of BI-CHROMOSOMAL SNPs that constitute APOE alleles: ε2 ε3 ε4
APOE STATUS (GRCh37 CHR19:POSITION) APOE 2 45411941 ( T ) 45412079 ( T ) APOE 3 45411941 ( T ) 45412079 ( C ) APOE 4 45411941 ( C ) 45412079 ( C )
APOE 2/2 45411941 ( T , T ) 45412079 ( T , T ) APOE 2/3 45411941 ( T , T ) 45412079 ( T , C ) APOE 2/4 45411941 ( T , C ) 45412079 ( T , C ) APOE 3/3 45411941 ( T , T ) 45412079 ( C , C ) APOE 3/4 45411941 ( T , C ) 45412079 ( C , C ) APOE 4/4 45411941 ( C , C ) 45412079 ( C , C )
| APOE STATUS | GRCh37 CHR19 | |||||
|---|---|---|---|---|---|---|
| ALLELE | POS | SNP1 | SNP2 | POS | SNP1 | SNP2 |
| APOE 2/2 | 45411941 | T | T | 45412079 | T | T |
| APOE 2/3 | 45411941 | T | T | 45412079 | T | C |
| APOE 2/4 | 45411941 | T | C | 45412079 | T | C |
| APOE 3/3 | 45411941 | T | T | 45412079 | C | C |
| APOE 3/4 | 45411941 | T | C | 45412079 | C | C |
| APOE 4/4 | 45411941 | C | C | 45412079 | C | C |
GENOMIC LOCATIONS
| SNP | CHR | GRCh37.p13 | GRCh38.p7 | REF | ALT | |
|---|---|---|---|---|---|---|
| rs429358 | 19 | 45411941 | 44908684 | T | C | |
| rs7412 | 19 | 45412079 | 44908822 | C | T |
MORE DETAILS
One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.
SNP NAME GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG NC_000019.9 @ 45411941 @GRCh37.p13 : 19:45411941 NC_000019.10 @ 44908684 @GRCh38.p7 : 19:45411941 Variation ID: rs429358 Variant Type: SNP, length 1 Alleles: C/T
SNP NAME NC_000019.9 @ 45412079 @GRCh37.p13 : 19:45412079 NC_000019.10 @ 44908822 @GRCh38.p7 : 19:44908822 Variation ID: rs7412 Variant Type: SNP, length 1 Alleles: C/T
APOE on GNOMAD
Get more info about APOE variants on the GNOMAD database provided by a great team of genomics scientists at Broad institute. For convenience, I've pulled the relevant AD-related APOE loci (along with several nearby flanking positions) from GNOMAD and pasted them into this csv datatable.