APOE

From bradwiki
Revision as of 00:03, 17 December 2017 by Bradley Monk (talk | contribs)
Jump to navigation Jump to search

ApoE status is defined by these two SNPs:

rs429358 is located in the fourth exon of the ApoE gene (19:45411941), affects the amino acid at position 130 of the resulting protein; the more common allele is rs429358(T)(ref). If this allele is rs429358(C)(alt) and the same chromosome also harbors rs7412(C)(ref) allele, the combination is known as an APOE-ε4 allele.

Here are the various combinations of SNPs that constitute APOE alleles: ε2 ε3 ε4


   APOE ε2   |  rs429358( T ) + rs7412( T )
   
   APOE ε3   |  rs429358( T ) + rs7412( C )
   
   APOE ε4   |  rs429358( C ) + rs7412( C )


GENOMIC LOCATIONS


SNP CHR GRCh37.p13 GRCh38.p7 REF ALT
rs429358 19 45411941 44908684 T C
rs7412 19 45412079 44908822 C T



MORE DETAILS


One meta-analysis estimated the odds ratios for homozygous rs429358(C;C) individuals compared to the more common ApoE3/ApoE3 homozygotes to be 12x for late-onset Alzheimer's and 61x for early-onset disease. Note: Although ApoE status is technically defined by these two SNPs, rs429358 and rs7412, a SNP in the adjacent ApoC1 gene, rs4420638, is co-inherited with ApoE and thus often - though not completely - predictive of it.


VIEWER


   SNP NAME 
   GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG
   NC_000019.9  @ 45411941 @GRCh37.p13 : 19:45411941
   NC_000019.10 @ 44908684 @GRCh38.p7  : 19:45411941
   Variation ID:	rs429358
   Variant Type:	SNP, length 1
   Alleles:	    C/T


   SNP NAME
   NC_000019.9  @ 45412079 @GRCh37.p13 : 19:45412079
   NC_000019.10 @ 44908822 @GRCh38.p7  : 19:44908822
   Variation ID:	rs7412
   Variant Type:	SNP, length 1
   Alleles:	    C/T